Skip to main content

Table 1 Quantitative real-time primers

From: Fraternal twins with Phelan-McDermid syndrome not involving the SHANK3 gene: case report and literature review

No. primer position Sequence(5′-3′)
1 SHANK3-1F Intro 1 TGACCAGAGGCTGTTTTGAG
2 SHANK3-1R Intro 1 CAGCAGATCCACCTCGACC
3 SHANK3-8F Intro 8 CCTGCGCACGCCATGT
4 SHANK3-8R Intro 8 GAGACCATCCGAGCACAACA
5 SHANK3-11F Intro 11 CACCTGTGTAGTGATGGGCT
6 SHANK3-11R Intro 11 CTCTCCACCTAACACGCTCC
7 SHANK3-17F Exon 17 CGCCTCGTCATGAAGGTTGT
8 SHANK3-17R Exon 17 CGAGCCCCGTCCTCTTCT
9 SHANK3-22F Exon 22 GGAGAGCGGGGAACTCACT
10 SHANK3-22R Exon 22 CTGTCCGAGGACTGCTTCAG
11 SHANK3-23F Exon 23 ACTCATCCTTCCGCCAACAG
12 SHANK3-23R Exon 23 CCCACAGGTGAGTGTGAGAC
13 FBLN1-4F Exon 4 AGAGCTGCGAGTACAGCCT
14 FBLN1-4R Exon 4 CGACATCCAAATCTCCGGTCT
15 FBLN1-11F Intro11 GGACCTCTGTCTCTCCGAGT
16 FBLN1-11R Intro11 ACCGCTCAGAGCATCATACG
17 FBLN1-14F Intro14 TCCTCCCATGAGGGACTCAG
18 FBLN1-14R Intro14 CACAGCCTTGGCCTGAAAAC
19 GAPDH-8F Intro 8 ACTGGCTCTTAAAAAGTGCAGGGT
20 GAPDH-8R Intro 8 TTGCTGTAGCCAAATTCGTTGTC