Skip to main content

Table 2 The characteristics and sequences of primers used for detection of genes polymorphisms

From: Association of CATSPER1, SPATA16 and TEX11 genes polymorphism with idiopathic azoospermia and oligospermia risk in Iranian population

Gene (polymorphism) Primer sequence (5′ → 3′) Products size: allele type
CATSPER1 (rs2845570) Forward outer: TCCAGCATGACGGTGTTGAGGCAGA
Reverse outer: ATATTCTTCTGCATCTACGTGGTGG
Forward inner: TTCTTGCGGGTCCGCTGGAGCCG
Reverse inner: TCTGGCCCTGTTCCTTTCAGCCGGCA
323 bp: allele G (A)
473 bp: –
198 bp: allele T (B)
SPATA16 (rs1515442) Forward outer: TAACATCCTGGAAATGTCACAAGAG
Reverse outer: TTCTTTAATCCCATACCTCAAGTGC
Forward inner: ATGAAGTTGGTCTACATTGATGAAA
Reverse inner: CTACAAACTCATAGCGAACACCCAC
256 bp: allele T (A)
515 bp: –
308 bp: allele C (B)
TEX11 (rs143246552) Forward outer: ATAGATTCCAATCAGCATTAGTAACATC
Reverse outer: AGGATTCAATATTTTCTCCAATATTCCC
Forward inner: TCACTCTCAACAGTAATCTTCTCCAT
Reverse inner: CCCTGAGGCTGACTTGACCG
348 bp: allele T (A)
563 bp: –
470 bp: allele C (B)