Skip to main content

Table 3 Altered Genes with Clinical Significance

From: Genomic features of Chinese small cell lung cancer

Gene OncoKB Annotation DDR signal pathway Coding_seq_change
BRCA2 Likely Oncogenic HR c.9294C > G
RAD50 Likely Oncogenic HR c.3618delATCTCTTGCCAATGCTCTGGTTGAGTAAGT
BRCA1 Likely Oncogenic HR c.4801A > T
BRCA1 Likely Oncogenic HR c.1465G > T
MSH2 Likely Oncogenic MMR c.640A > T
ATM Likely Oncogenic DS c.2376 + 1G > A