Skip to main content
Fig. 5 | BMC Medical Genomics

Fig. 5

From: Three-years misdiagnosis of Niemann Pick disease type B with novel mutations in SMPD1 gene as Budd-Chiari syndrome

Fig. 5

a. The patient’s SMPD1_ex6 c. c.1805G > A(p. R602H)Sanger. b. The patient’s S-MPD1_ex2 c.829 T > C(p. W277R)Sanger. c. The patient’s father SMPD1_ex6 c. c.1805G > A(p. R602H)Sanger. d. The patient’s father SMPD1_ex2 c.829 T > C(p. W277R)Sanger. e. The patient’s mother SMPD1_ex6 c. c.1805G > A(p. R602H)Sanger. f. The patient’s mother SMPD1_ex2 c.829 T > C(p. W277R)Sanger. a, c, e. NM_000543.4 sequence: CTCTCTGCCCGTGCTGACAGC. b, d, f. NM_000543.4 sequence: TATGGTGTACTGGACAGGAGA (This mutation naming rule refers to Human Genome Variation Society.)

Back to article page

BMC Medical Genomics

ISSN: 1755-8794

Contact us