Bioinformatics analysis
The levels of SH3PXD2B mRNA transcripts in HCC and non-tumor liver tissues in the TCGA database were analyzed by the GEPIA2 (http://gepia2.cancer-pku.cn/) [15] and the potential association of SH3PXD2B expression with the race, age, grade, stage, and other clinicopathological characteristics of HCC patients as well as their OS and RFS were analyzed after stratification, based on the median value of SH3PXD2B expression levels. In addition, the levels of SH3PXD2B expression in immunohistochemically analyzed 6 HCC and 3 non-tumor liver tissue sections available in the Human Protein Atlas database (https://www.proteinatlas.org/) [14] were analyzed using the Image-Pro Plus 6.0, Media, Cybernetics and expressed as the mean optical density (MOD) [15]. The detailed information on the subjects and analysis is shown in the Additional file 1. The OS was defined as the period from the surgery day to the death day or the last contact day. The RFS was defined as the period from the surgery day to the tumor recurrence day.
HCC tissue samples
A total of 89 HCC patients were recruited at the Second Affiliated Hospital of Kunming Medical University from January 2016 to December 2018. Their HCC and adjacent non-tumor liver tissue samples were collected when they underwent a hepatectomy to remove the tumors. Those patients were diagnosed, based on clinical symptoms, laboratory and radiological examinations as well as pathological confirmation. HCC patients with transcatheter arterial chemoembolization, chemotherapy, or radiotherapy before surgery were excluded. All patients were regularly followed-up until December 2019. All patients have signed the written informed consent and the study was approved by the Institutional Review Boards of the Second Affiliated Hospital of Kunming Medical University. Twenty-eight pairs of fresh tissue specimens were snap-frozen in liquid nitrogen and used for qRT-PCR in our study. Other specimens were fixed in formalin and paraffin-embedded for immunohistochemistry.
RNA extraction and quantitative real-time PCR analysis
Total RNAs were extracted from fresh tissue samples using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed into cDNA using the PrimeScript RT reagent Kit (TaKaRa, Japan) after treatment with RNase-free DNase I (Promega, USA). The relative levels of SH3PXD2B mRNA transcripts in individual samples were quantified in triplicate by qRT-PCR using the SYBR Premix Ex Taq (Takara) and specific primers F: AGATTCTCTTCAGACGAA and R: GCCTTACAGTATTCATCAA for SH3PXD2B; and F: TGTTGCCATCAATGACCCCT and R: TCGCCCCACTTGATTTTGGA for GAPDH. The data were analyzed by the 2-ΔΔCT method.
Immunohistochemistry (IHC)
The levels of SH3PXD2B protein expression in HCC and adjacent tissues were determined by IHC. Briefly, the HCC and adjacent tissue sections (4 μm) were dewaxed, rehydrated, and immersed in 3% methanol to inactivate endogenous peroxidase. After being washed, the sections were blocked with 5% BSA in TBST and incubated with rabbit polyclonal antibodies against SH3PDX2B (PA5-57673, Invitrogen, 1:500 dilution) at 4 °C overnight. The bound antibodies were detected with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Maixin Bio, Fujian, China) and visualized by diaminobenzidine (DAB). The intensity of anti-SH3PXD2B protein staining was determined as a MOD by Image-Pro Plus 6.0 (Media, Cybernetics). A non-stained region was selected and served as the background.
Cell culture
Human HCC Hep3B and Huh7 cells were obtained from the Kunming Cell Bank, Kunming Institute of Zoology, Chinese Academy of Sciences (Kunming, China) and identified by short tandem repeat (STR) analysis. Hep3B and Huh7 cells were cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 units/ml of penicillin and 100 μg/ml of streptomycin at 37 °C in a humidified incubator with 5% CO2.
Generation of lentiviruses and transduction
The SH3PXD2B-specific small hairpin RNA (sense: 5′-GGTGCCCAACAAGCATTATGT-3′) and control (sense: 5′-TTCTCCGAACGTGTCACGT-3′) shRNAs were synthesized and cloned into the plasmid of pGLVU6/GFP. The generated plasmids, together with packaging plasmids, were co-transfected into 293T cells using lipofectamine 3000 (Invitrogen) to generate different types of recombinant lentivirus virions. HCC cells were transduced with each type of lentivirus at a multiplicity of infection (MOI) of 5 and cultured in the presence of 4 μg/ml of puromycin for 7 days to generate stably SH3PXD2B-silenced or control cells. The efficacy of SH3PXD2B silencing was determined by Western blot.
Western blot assay
The relative levels of SH3PXD2B to β-tubulin proteins were determined by Western blot. Briefly, different groups of cell lysates (30 μg/lane) were separated by SDS-PAGE on 12% gels and transferred onto PVDF membranes. After being blocked, the membranes were probed with rabbit polyclonal anti-SH3PDX2B antibodies (PA5-57673, Invitrogen), anti-β-tubulin antibodies (PA5-16863, Invitrogen). The bound antibodies were detected with HRP-conjugated goat anti-rabbit IgG (H + L) (G-21234, Invitrogen) and visualized using the enhanced chemiluminescent reagents. The data were analyzed by densitometry using the Image J software.
Cell proliferation curves
The different groups of HCC cells (1 × 105 cells/well) were cultured in triplicate for varying periods and the numbers of viable cells per well were determined after trypan blue staining.
Transwell invasion assays
The different groups of HCC cells (1 × 105 cells/well) were cultured in the serum-free medium in the upper chambers that had been coated with ECMatrixTM. The lower chambers were filled with 10% FBS DMEM medium. After cultured for 24 h, the cells on the top surface of the upper chambers were removed, and the cells on the bottom surface were stained with crystal violet. The numbers of invaded cells per field were counted and 10 random fields at 200 × magnification were analyzed.
Invadopodium formation assays
The impact of SH3PXD2B silencing on the invadopodium formation was determined by invadopodium formation assay, as described previously [16]. Briefly, the different groups of HCC cells were cultured on coverslips coated with gelatin (50 μg/ml, G1890, Sigma-Aldrich, St. Louis, MO). Eight hours later, the cells were fixed for immunofluorescence using rabbit anti-Cortactin [EP1922Y] (1:1,000, ab81208, Abcam, Cambridge, MA) and Alexa Fluor® 488-labeled goat anti-rabbit IgG (2 μg/ml, ab150081, Abcam) as well as Alexa Fluor™ 568-labeled Phalloidin (1:200, A12380, Invitrogen). Subsequently, the cells were nuclear-stained with DAPI (Invitrogen). The fluorescent signals were captured under a confocal microscope (Nikon A1, Tokyo, Japan) and analyzed using NIS-Elements Free Viewer Ver4.20.00.
In situ zymography
The effects of SH3PXD2B silencing in HCC cells on the invadopodium-associated matrix degradation were analyzed by in situ zymography [16]. Briefly, the different groups of cells were cultured on coverslips coated with FITC-conjugated gelatin (M1303-1, BioVision, Milpitas, CA). Eight hours later, the cells were fixed and stained with Alexa Fluor™ 568-labeled Phalloidin (1:200, A12380, Invitrogen) and nuclear-stained with DAPI. The fluorescent signals were captured under a confocal microscope (Nikon A1, Tokyo, Japan) and analyzed using NIS-Elements Free Viewer Ver4.20.00.
Statistical analysis
Data analyses were performed using IBM SPSS Statistics 22.0 (IBM, Armonk, NY, USA). Data are expressed as mean ± standard deviation or case number. The difference between groups was analyzed by the Student’s t-test, paired t-test, Cochran-Armitage trend test, and chi-square test where applicable. HCC patients were stratified into the higher and lower SH3PXD2B mRNA transcription groups, based on the median value. Their OS and RFS were estimated by the Kaplan–Meier method and analyzed by the log-rank test. Similarly, HCC patients were stratified into the higher and lower groups, based on the least P value for their OS determined using the X-Tile software (Yale University, New Haven, CT). Statistical significance was declared when a P value < 0.05.
