Circulating adiponectin levels, expression of adiponectin receptors, and methylation of adiponectin gene promoter in relation to Alzheimer’s disease

Table 1 A list of primers

#	Primer name	Primer sequence 5′ –» 3′	Gene	PCR product
1	− 74nt—F	TGCCCCATCTTCTGTTGCTG	− 74nt ADIPOQ	186 base pairs
2	− 74nt—R	AACTCGATGAGGGCCAGAGG	− 74nt ADIPOQ	186 base pairs
3	Beta-globin—F	CCACTTCATCCACGTTCACC	Beta-globin	268 base pairs
4	Beta-globin—R	GAAGAGCCTAGGACAGGTAC	Beta-globin	268 base pairs

ISSN: 1755-8794