Skip to main content
Download PDF

The role of NOS3-rs1799983 and NOS3- rs2070744 SNP in occurrence of avascular necrosis as a post COVID-19 complication

BMC Medical Genomics volume 17, Article number: 217 (2024) Cite this article

Abstract

Avascular necrosis (AVN) is a debilitating condition characterized by bone tissue death due to inadequate blood supply, leading to joint dysfunction and collapse. This study investigates the potential association between AVN and COVID-19, focusing on genetic factors such as NOS3 polymorphisms. A total of 180 individuals were included, comprising 120 COVID-19 patients and 60 healthy controls. Clinical, haematological, biochemical, and genetic parameters were assessed. Results revealed significant differences in respiratory and heart rates, haematological counts, and biochemical markers between AVN and control groups. Genetic analysis showed a higher prevalence of the TG genotype and G allele in NOS3 rs1799983 polymorphism among AVN patients. Additionally, NOS3 rs2070744 polymorphism correlated with various clinical parameters, including blood pressure, heart rate, and haematological indices. This study highlights the potential role of genetic factors in predisposing individuals to AVN following COVID-19 infection.

Peer Review reports

Introduction

Avascular necrosis (AVN) is a debilitating condition characterized by the death of bone tissue due to poor blood supply, resulting in pain, joint dysfunction, and, ultimately, joint collapse [1]. AVN has been associated with various risk factors, including trauma, corticosteroid use, alcohol consumption, and certain medical conditions [2]. Emerging evidence suggests that viral infections, such as COVID-19, may also predispose individuals to AVN as a post-infectious complication [3,4,5].

The global COVID-19 pandemic has had profound implications for public health, with millions of individuals affected by the virus worldwide [6]. While COVID-19 primarily manifests as a respiratory illness, increasing reports indicate its involvement in diverse systemic manifestations, including musculoskeletal complications [7]. Avascular necrosis has been identified as one such complication, with reports of its occurrence following COVID-19 infection [8].

Genetic factors are known to play a crucial role in the pathogenesis of AVN, influencing an individual’s susceptibility to the condition [9]. Among these factors, single nucleotide polymorphisms (SNPs) in genes related to vascular function and regulation have garnered significant interest. One such gene is nitric oxide synthase 3 (NOS3), which encodes an enzyme involved in the production of nitric oxide, a key regulator of vascular tone and endothelial function [10]. Two common NOS3 SNPs, rs1799983 and rs2070744, have been implicated in various vascular disorders, raising the possibility of their involvement in AVN as well [11].

Despite the growing recognition of the potential link between COVID-19 and AVN, the underlying mechanisms remain poorly understood. Furthermore, the contribution of genetic factors, particularly NOS3 SNPs, to the development of AVN in the context of COVID-19 has not been adequately investigated [12]. Therefore, this study aims to elucidate the role of NOS3-rs1799983 and NOS3-rs2070744 SNPs in the occurrence of AVN as a post-COVID-19 complication.

By examining the association between these genetic variants and AVN risk in individuals recovering from COVID-19, we seek to provide insights into the pathogenesis of post-infectious AVN and identify potential genetic markers for risk stratification and targeted interventions. This research has the potential to advance our understanding of the interplay between viral infections, genetic susceptibility, and musculoskeletal health, ultimately informing clinical management strategies for patients recovering from COVID-19.

Subjects and methods

Subjects and control samples

A total of 180 subjects of both sexes were included in this study; 120 of them were confirmed with COVID-19 disease with different severity, and 60 were healthy. The patients were selected from confirmed patients with the COVID-19 pandemic in El-Bagour Hospital in the period from March 2021 to December 2021.

Study design

In this study, participants were categorized into three distinct groups: a control group comprising sixty healthy individuals (GpI), a non-avascular necrosis infected COVID-19 group (GpII) consisting of sixty patients, and a post-COVID-19 avascular necrosis group (GpIII) also comprising sixty subjects. The study adhered to the principles outlined in the Helsinki Declaration for ethical research. This included obtaining voluntary, informed consent from all participants, ensuring their privacy and confidentiality, minimizing potential risks, and conducting the research with scientific rigor and integrity. Additionally, the study protocol underwent ethical review and approval by the Menoufia University Faculty of Medicine’s Ethical Committee for Medical Research (11/2023 BIO12), further demonstrating its commitment to ethical standards.

Assessment of COVID-19 severity

In this study, the ABCD (Airway, Breathing, Circulation, Defibrillation) severity score specifically designed for COVID-19 was employed. This scoring system incorporates various factors to assess the severity of the condition, as detailed in Table 1. The score was determined based on the presence and severity of these factors according to the established criteria [13].

Table 1 ABCD scoring for COVID-19 severity assessment
Full size table

Complete blood count (CBC)

In the methodology, an automated hemogram was conducted for all participants. This included the estimation of hemoglobin levels (Hb), the count of white blood cells (WBC), lymphocytes, and platelets (PLT). These parameters were assessed using a Coulter counter model Beckman 750, manufactured by Int, U.S.A., following the same procedures as previously described.

Determination of biochemical parameters

Biochemical parameters were determined by assessing levels of C-reactive protein (CRP) using the Cromatest Linear Chemicals S.L.U. Barcelona Spain kit, following the manufacturer’s instructions and protocols. D-dimer levels were measured according to a previously described method [14], while ferritin levels were determined based on established protocols [15]. Interleukin-6 (IL-6) levels were also assessed, adhering to the manufacturer’s instructions for the assay procedure (SHANGHAI KORAIN BIOTECH CO., LTD., Shanghai, China).

Genotyping of polymorphisms

Genomic DNA was extracted from all frozen gastric tissue samples using Quick-g DNA TM Miniprep Kit, USA (catalogue No D3024) and SNP (single nucleotide polymorphism) assay using TaqMan Allelic Discrimination Technique. The rs2070744 polymorphism was genotyped using the Primer probe for rs2070744: [VIC/FAM]: CCAGGGCATCAAGCTCTTCCCTGGC[C/T] GGCTGACCCTGCCTCAGCCCTAGTC and Primer probe for rs1799983: [VIC/FAM]: CCCTGCTGCTGCAGGCCCCAGATGA [G/T] CCCCCAGAACTCTTCCTTCTGCCCC.

After PCR amplification, an endpoint plate was read using an Applied Biosystems Real-Time PCR System. The genotyping run results were recorded by the system software on a scatter plot of Allele G versus Allele A. On the plot, each well of the 96-well reaction plate is represented by a distinct point.

Statistical analysis

Data were entered into the computer and analyzed with the version of the IBM SPSS software package 25.0. The standard deviation, mean, range (minimum and maximum), and median were used to express distributed data. The three groups under investigation were compared using an ANOVA, and pairwise comparisons were made using the Post Hoc Tukey test. To compare the two groups, the Chi-square test was used. At the 5% level, the significance of the results was determined.

Results

Clinical characteristics of patients

According to respiratory rate, there was a statistically significant difference between the three studied groups (p = 0.001), with a higher value in (GpIII) followed by the (GpII) than (GpI). Our data showed that heart rate was statistically significantly higher among (GpIII) than the (GpII) as compared to (GpI) (p = 0.001). Mean OS was statistically significantly lower among (GpIII) than among (GpII) and (GpI) (p = 0.001) (Table 2).

Hematological and biochemical test numbers and percentages

According to the results, there were low WBC counts (x103) in (GpII) (2.8 ± 0.4) and (GpIII) (2.8 ± 0.2) groups with statistically significant differences as compared to (GpI) (7.3 ± 1.6) (p = 0.001). Also, there were low PLT counts (x103) in (GpII) (130.8 ± 13.2) and (GpIII) (129 ± 6.3) groups with statistically significant difference as compared to (GpI) (293 ± 56) (p = 0.001) as shown in Table 2.

Our data showed increased levels for D-dimer, CRP, ferritin and IL-6 tests in (GpII) and (GpIII) compared to (GpI). D-dimer values showed a statistically significant difference between (GpII) (1.5 ± 0.2) and (GpIII) (1.4 ± 0.1) groups as compared to (GpI) (0.2 ± 0.1) (p = 0.001). However, there was a statistically significant difference between the three studied groups according to CRP, ferritin and IL-6 (p = 0.001).

Polymorphism of NOS3

Additionally, it was observed that there was a statistically significant difference in the genotype and allele distributions of the NOS3-rs1799983 polymorphism between the patient and control groups. The TG genotype was higher in (GpIII) (60%). The T allele was significantly higher in (GpI) (65%), and the G allele was significantly higher in (GpIII) (47.5%, Table 3). The odds ratio showed that there was a statistically significant difference in TG (p = 0.020) and GG (p = 0.009) genotype and G allele (p = 0.049) in (GpIII) as compared with (GpI) (Table 4).

Table 2 Comparison of the three studied groups according to different variables
Full size table
Table 3 Comparison of the three studied groups according to rs1799983
Full size table

Comparing COVID-19 patient results of hematological and biochemical parameters according to NOS3-rs2070744

For subjects IN (GpII) (Table 5 ), statistically significant differences were noticed in systolic blood and diastolic blood pressures (p = 0.02 and 0.047) with high value in CC genotype and low value in CT genotype, heart rate (p = 0.044) with high value in TT genotype and low value in CC genotype, Hb (p = 0.017) with high value in CT genotype and low value in CC genotype, PLT count (p = 0.031) with high value in CT genotype and low value in TT genotype. In (GpIII) (Table 6), statistically significant differences were observed in temperature, heart rate, lymphocyte count and CRP (p = 0.018, 0.022, 0.009 and 0.007) with high values in CT genotype and low values in CC genotype, OS, (p = 0.032) with high value in CC genotype and low value in TT genotype, WBC count and D-dimer (p = 0.011 and 0.001) with high value in CT genotype and low value in TT genotype, Hb and mortality (p = 0.002 and 0.001) with high value in CC genotype and low value in CT genotype and finally age (p = 0.045) with high value in TT genotype and low value in CC genotype. Our results showed a statistically significant difference (p = 0.015) between avascular necrosis complication and NOS3-rs2070744, with a high value in the CT genotype and a low value in the TT genotype.

Table 4 Odds ratio
Full size table
Table 5 Relation between rs2070744 and different parameters in group II (n = 60)
Full size table

Comparing COVID-19 patient results of hematological and biochemical parameters according to NOS3-rs1799983

For comparing the hematological tests and biochemical parameters to NOS3-rs1799983, a statistically significant difference was observed in (GpIII), statistically significant differences were observed in WBC and PLT counts (p < 0.001 and 0.044) with high value in the TT genotype and low value in GG genotype (Table 7).

Table 6 Relation between rs2070744 and various parameters in group III (n = 60)
Full size table
Table 7 Relation between rs1799983 and various parameters in group III (n = 60)
Full size table

Discussion

Numerous clinical characteristics of COVID-19 are present, ranging from asymptomatic or mild to severe or serious form [16].

This is the first study that investigated the relationship between the polymorphisms rs2070744 and rs1799983 of the NOS3 gene and avascular necrosis complications in COVID-19 patients.

In this study, we reported that respiratory rate is often increased in patients diagnosed with COVID-19 when compared with healthy controls. This is comparable to other studies showing a higher respiratory rate in patients with COVID-19 [17, 18].

Compared to uninfected or healthy controls, an increase in heart rate was observed in individuals with COVID-19. On the other hand, consistent differences between the non-avascular necrosis and post-COVID-19 avascular necrosis groups were not observed. These findings come in agreement with the study of Maloberti et al., 2021 [19]. OS showed a significant difference with post-COVID-19 avascular necrosis COVID-19 in comparison with non-avascular necrosis and healthy groups.

Patients with COVID-19 pneumonia may have normal, low, or high leukocyte count. This might also make it easier to monitor the disease’s development and facilitate treatment-related decisions. Our data investigated that WBC and PLT counts were statistically significantly lower in the non-avascular necrosis and post-COVID-19 avascular necrosis groups than in the healthy group. These findings come in agreement with the study of Xiong et al., 2020 and Zheng et al., 2020 [20, 21].

In regard to the findings of the previous studies, IL-6 has been introduced as a catalyst for the cytokine storm in COVID-19 and is a powerful pro-inflammatory cytokine that can stimulate CRP. This hyperinflammatory condition raises CRP and IL-6 levels, which is consistent with the findings of previous studies. Interleukin-6, interleukin-10 (IL-10) and CRP are substantially linked with the severity of the illness, according to study results by Keddie et al. [22, 23].

Our study found that mean D-dimmer and S-ferritin levels were statistically significantly higher in the positive COVID-19 groups than in the negative group, which agrees with studies of Alkan et al., 2021 and Assar et al., 2023 [24, 25].

NO has a crucial role in preventing RNA and DNA viruses from replicating. NO declines with age and has a potentially fatal effect on COVID-19 infection in older adults, while it is also regarded as a crucial protective component [26]. In our study, there was no significant difference found between healthy and COVID-19 groups according to NOS3-rs2070744 polymorphism in neither genotype nor allele distribution. Even so, the genotype and allele distribution of the NOS3-rs1799983 polymorphism were observed to be statistically significantly different. The TG genotype and the G allele were higher in post COVID-19 avascular necrosis group, while the T allele was higher in healthy controls, while another study reported that there was no significant difference found between COVID-19 and healthy controls [27].

When comparing rs1799983 with different parameters, we observed that WBC and PLT counts in post post-COVID-19 avascular necrosis group were statistically significant differences.

About rs2070744, we noticed that heart rate and Hb were statistically significant differences in both non-avascular necrosis and post-COVID-19 avascular necrosis groups. Systolic, diastolic blood pressure and PLT count were statistically significant differences in the non-avascular necrosis group. In post COVID-19 avascular necrosis group, Age, temperature, OS, WBC count, lymphocyte count, D-dimer and CRP were statistically significant differences.

Long COVID is a complicated, multifactorial condition that has been demonstrated to affect almost all organ systems, including inducing a severe prothrombotic state in both the microvascular and macrovascular levels [28]. There are very few case reports of femoral AVN following a COVID-19 infection [29].

Our study showed that genotypes of the polymorphisms 1,799,983 in post-COVID-19 avascular necrosis had no significant association with the susceptibility of AVN, in agreement with the study of Zhao et al.,2019 showed the association of NOS3 rs1799983 polymorphism with osteonecrosis of the femoral head (ONFH) and in Chinese Han population, its T allele may be a protective factor against ONFH occurrence [30]. On the other hand, genotypes of the polymorphism rs2070744 had a significant association with avascular necrosis complications.

Patients, after being treated for COVID-19 infection, developed AVN of the femoral head, according to the study of Agarwala, S.R. et al., 2021 [31]. The hypothesis that the use of corticosteroids with COVID-19 raises the risk of AVN while lowering the onset of COVID-19-related respiratory symptoms is supported by a number of case studies. The case study of Kingma T.J. et al., 2022 showed that Long COVID is a complex condition which has contributed to the development of bilateral hip AVN in COVID-19 patients as COVID-19 affect intravascular blood flow causing a hypercoagulable state. In order to prevent catastrophic outcomes like bone collapsing, AVN must be examined early when evaluating anterior hip pain in individuals with a history of COVID-19 infection [32]. Bone loses its smooth shape as a result of AVN, which may cause severe arthritis. Also, other studies evaluated the relationship between AVN and COVID-19 [33].

Conclusion

In conclusion, our findings suggest a potential link between COVID-19 infection and AVN development, with genetic factors such as NOS3 polymorphisms playing a significant role. The higher prevalence of specific genotypes and alleles among AVN patients underscores the importance of genetic susceptibility in post-infectious complications. Understanding these genetic mechanisms can aid in risk stratification and targeted interventions for AVN patients recovering from COVID-19. Further research is warranted to elucidate the underlying pathophysiological mechanisms and validate these genetic markers in larger cohorts. Ultimately, integrating genetic profiling into clinical management strategies may improve outcomes for individuals predisposed to AVN following viral infections like COVID-19.

Data availability

The datasets generated and/or analyzed during the current study are available in the dbSNP repository, with the primary accession code NC_000007.14.

Abbreviations

AVN:

Avascular necrosis

COVID-19:

Coronavirus disease 2019

NOS3:

Nitric oxide synthase 3

SNP:

Single nucleotide polymorphism

ABCD:

Airway, Breathing, Circulation, Defibrillation

Hb:

Hemoglobin

WBCs:

White blood cells count

PLT:

Patelet

IL-6:

Interleukin-6

CRP:

C-reactive protein

ONFH:

Osteonecrosis of the femoral head

References

  1. Nejadhosseinian M et al. Who is the convict; COVID-19 or corticosteroid? Late onset avascular necrosis of hips after COVID‐19. A case report with literature review. Int J Rheum Dis, 2023.

  2. Shah KN, et al. Pathophysiology and risk factors for osteonecrosis. Curr Rev Musculoskelet Med. 2015;8:201–9.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Angulo-Ardoy M, Ureña-Aguilera Á. Knee osteonecrosis after COVID-19. Fam Pract. 2021;38(Supplement1):i45–7.

    Article  PubMed  Google Scholar 

  4. Ghosh S, et al. COVID-19–Associated Bone Marrow Necrosis—A Case Report. Indian J Radiol Imaging. 2021;31(03):725–8.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Zhang S et al. Beware of steroid-induced avascular necrosis of the femoral head in the treatment of COVID-19—Experience and lessons from the SARS epidemic Drug design, development and therapy, 2021: pp. 983–995.

  6. Raza T, et al. Impact assessment of COVID-19 global pandemic on water, environment, and humans. Environ Adv. 2023;11:100328.

    Article  CAS  PubMed  Google Scholar 

  7. da Silva LN, Guimarães JB. Musculoskeletal manifestations of COVID-19 Skeletal Radiology, 2023: pp. 1–14.

  8. Sehrawat S et al. Is COVID-19 an independent risk factor for the development of avascular necrosis of the hip? A retrospective study to evaluate the factors associated with avascular necrosis of the hip in patients who had COVID-19 infection. Int Orthop, 2023: p. 1–8.

  9. Kumar P et al. Association of Specific Genetic Polymorphisms with atraumatic osteonecrosis of the femoral head: a narrative review. Indian J Orthop, 2022: p. 1–14.

  10. Oliveira-Paula GH, Lacchini R, Tanus-Santos JE. Endothelial nitric oxide synthase: from biochemistry and gene structure to clinical implications of NOS3 polymorphisms. Gene. 2016;575(2):584–99.

    Article  CAS  PubMed  Google Scholar 

  11. Lee S, Yoo J-I, Kang Y-J. Integrative analyses of genes related to femoral head osteonecrosis: an umbrella review of systematic reviews and meta-analyses of observational studies. J Orthop Surg Res. 2022;17(1):182.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Bordea IR, et al. Coronavirus (SARS-CoV-2) pandemic: future challenges for dental practitioners. Microorganisms. 2020;8(11):1704.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Salunke AA, et al. A proposed ABCD scoring system for better triage of patients with COVID-19: use of clinical features and radiopathological findings. Volume 14. Diabetes & Metabolic Syndrome: Clinical Research & Reviews; 2020. pp. 1637–40. 6.

    Google Scholar 

  14. Freyburger G, Labrouche S. Comparability of D-dimer assays in clinical samples. in Seminars in Vascular Medicine. 2005. Copyright© 2005 by Thieme Medical Publishers, Inc., 333 Seventh Avenue, New &#8230.

  15. Forman D, Parker S. The measurement and interpretation of serum ferritin. Annals Clin Lab Sci. 1980;10(4):345–50.

    CAS  Google Scholar 

  16. Guan W-j, et al. Clinical characteristics of coronavirus disease 2019 in China. N Engl J Med. 2020;382(18):1708–20.

    Article  CAS  PubMed  Google Scholar 

  17. Alhuthail E, et al. Measurement of breathing in patients with post-COVID-19 using structured light plethysmography (SLP). BMJ open Respiratory Res. 2021;8(1):e001070.

    Article  Google Scholar 

  18. Natarajan A, et al. Measurement of respiratory rate using wearable devices and applications to COVID-19 detection. NPJ Digit Med. 2021;4(1):136.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Maloberti A, et al. Heart rate in patients with SARS-CoV-2 infection: prevalence of high values at discharge and relationship with disease severity. J Clin Med. 2021;10(23):5590.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Xiong M, Liang X, Wei YD. Changes in blood coagulation in patients with severe coronavirus disease 2019 (COVID-19): a meta‐analysis. Br J Haematol. 2020;189(6):1050.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Zheng Z, et al. Risk factors of critical & mortal COVID-19 cases: a systematic literature review and meta-analysis. J Infect. 2020;81(2):e16–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Keddie S, et al. Laboratory biomarkers associated with COVID-19 severity and management. Clin Immunol. 2020;221:108614.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Nikkhoo B, et al. Elevated interleukin (IL)-6 as a predictor of disease severity among Covid-19 patients: a prospective cohort study. BMC Infect Dis. 2023;23(1):1–6.

    Article  Google Scholar 

  24. Alkan G et al. Evaluation of hematological parameters and inflammatory markers in children with COVID-19 Irish Journal of Medical Science (1971-), 2021: pp. 1–9.

  25. Assar EH, et al. Hematological changes with Covid-19 and Post Covid-19 syndrome and its outcome in hospitalized children in Benha Children Hospital. Benha Med J. 2023;40(Annual conference issue):182–93.

    Google Scholar 

  26. Guan SP, Seet RCS, Kennedy BK. Does eNOS derived nitric oxide protect the young from severe COVID-19 complications? Ageing Res Rev. 2020;64:101201.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Pehlivan S, et al. Investigation of MBL2 and NOS3 functional gene variants in suspected COVID-19 PCR (–) patients. Pathogens Global Health. 2022;116(3):178–84.

    Article  CAS  PubMed  Google Scholar 

  28. Manolis AS, et al. COVID-19 infection: viral macro-and micro-vascular coagulopathy and thromboembolism/prophylactic and therapeutic management. J Cardiovasc Pharmacol Therap. 2021;26(1):12–24.

    Article  CAS  Google Scholar 

  29. Sulewski A, et al. Avascular necrosis bone complication after active COVID-19 infection: preliminary results. Medicina. 2021;57(12):1311.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Zhao X, et al. Association between NOS3 polymorphisms and osteonecrosis of the femoral head. Artif Cells Nanomed Biotechnol. 2019;47(1):1423–7.

    Article  CAS  PubMed  Google Scholar 

  31. Agarwala SR, Vijayvargiya M, Pandey P. Avascular necrosis as a part of ‘long COVID-19’. BMJ Case Rep CP. 2021;14(7):e242101.

    Article  Google Scholar 

  32. Kingma TJ et al. Avascular necrosis of the hip: a post COVID-19 sequela. Cureus, 2022. 14(10).

  33. Assad SK, et al. Avascular necrosis of femoral head following COVID-19 infection. Annals Med Surg. 2023;85(9):4206–10.

    Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Author information

Authors and Affiliations

  1. Department of Chemistry, Biochemistry Division, Faculty of Science, Menoufia University, Menoufia, Egypt

    Eman Abd Allah Mahmoud Fouda & Doaa Gawesh

  2. Department of Medical Biochemistry, Faculty of Medicine, Menoufia University, Menoufia, Egypt

    Eman AE Badr

  3. Department of Chemistry, Faculty of Science, Kafrelsheikh University, Kafrelsheikh, 33516, Egypt

    Mohammad A. Mahmoud

Authors
  1. Eman Abd Allah Mahmoud Fouda
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Eman AE Badr
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Doaa Gawesh
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Mohammad A. Mahmoud
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization, E.A.F., E.A.B.; data analysis, E.A.F., E.A.B., D.G., M.A.M; Writing—original draft, E.A.B., D.G., M.A.M; L revised the final version of the manuscript, E.A.F., E.A.B., D.G., M.A.M. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Mohammad A. Mahmoud.

Ethics declarations

Ethics approval and consent to participate

This study has been approved by the Menoufia University Faculty of Medicine’s Ethical Committee for Medical Research (ethics approval number and date: 11/2023 BIO12). Informed consent was obtained from each patient before taking part. Moreover, all methods were carried out in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Conflict of interest

The authors declare no conflict of interest.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Fouda, E.A.A.M., Badr, E.A., Gawesh, D. et al. The role of NOS3-rs1799983 and NOS3- rs2070744 SNP in occurrence of avascular necrosis as a post COVID-19 complication. BMC Med Genomics 17, 217 (2024). https://doi.org/10.1186/s12920-024-01928-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12920-024-01928-1

Keywords

BMC Medical Genomics

ISSN: 1755-8794

Contact us